Skip to content

Custom Adapter and Primer Sequences

Dorado will automatically detect and trim any adapter or primer sequences it finds. The specific sequences it searches for depends on the specified sequencing kit. Dorado basecaller, can get this information from read metadata in the input pod5. Dorado trim however, requires that the sequencing kit is specified using the command-line option.

In some cases, it may be necessary to find and remove adapter and/or primer sequences that would not normally be associated with the sequencing kit that was used, or you may be working with older data for which the sequencing kit and/or primers being used are no longer directly supported by Dorado (for example, anything prior to kit14). In such cases, you can specify a custom adapter/primer file, using the command-line option --primer-sequences. If this option is used, then the sequences encoded in the specified --primer-sequences file will be used instead of the default sequences.

Custom adapter/primer file format

The custom adapter/primer file uses the FASTA file format, where the desired adapter/primer sequences are specified with additional metadata to define how each sequence should be used.

The following is an example adapter sequence:

>LSK109_front type=adapter kits=SQK-PSK004,SQK-LSK109
AATGTACTTCGTTCAGTTACGTATTGCT

The syntax rules are as follows:

Record Name

The record name must be of the form [id]_front or [id]_rear.

The id must be unique other than for the _front and _rear pair.

Type

Immediately following the record name must be a space, followed by either type=adapter or type=primer.

Kits (Optional)

Following the type designator, you can have an additional space, followed by kits=[kit1],[kit2],[kit3],....

How Dorado searches for adapters/primers

The _front and _rear record name suffixes and the type designator defines how Dorado will search for the sequence.

For adapters:

Dorado will search for front sequence near the beginning of the read, and for rear sequence near the end of the read.

For primers:

Dorado will search for the front and rear sequences near the beginning and end of the read.

Dorado will also search for the reverse-complement of the rear sequence near the beginning of the read, and for the reverse-complement of the front sequence near the end of the read.

The kits designator is optional. If provided, the sequence will only be searched for if the sequencing-kit information in the read matches any of the kit names in the custom file. If the kits designator is not provided, then the sequence will be searched for in all reads, regardless of the kit that was used. If the kit is not present the sequence will be searched for regardless of the read metadata in Dorado basecaller or sequencing kit selection in Dorado trim.

Example custom adapter/primer file

The following could be used to detect the PCR_PSK_rev1 and PCR_PSK_rev2 primers, along with the LSK109 adapters, for older data.

>LSK109_front type=adapter
AATGTACTTCGTTCAGTTACGTATTGCT

>LSK109_rear type=adapter
AGCAATACGTAACTGAACGAAGT

>PCR_PSK_front type=primer
ACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACC

>PCR_PSK_rear type=primer
AGGTTAAACACCCAAGCAGACGCCGCAATATCAGCACCAACAGAAA

In this case, the above adapters and primers would be searched for in all reads, regardless of the sequencing-kit information encoded in the read file, or in the case of dorado trim, regardless of the sequencing-kit specified on the command-line.

To restrict the search to only primers in reads where SQK-PSK004 specified as the kit name, and adapters if reads were from either SQK-PSK004 or SQK-LSK109, then the following could be used.

>LSK109_front type=adapter kits=SQK-PSK004,SQK-LSK109
AATGTACTTCGTTCAGTTACGTATTGCT

>LSK109_rear type=adapter kits=SQK-PSK004,SQK-LSK109
AGCAATACGTAACTGAACGAAGT

>PCR_PSK_front type=primer kits=SQK-PSK004
ACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACC

>PCR_PSK_rear type=primer kits=SQK-PSK004
AGGTTAAACACCCAAGCAGACGCCGCAATATCAGCACCAACAGAAA